Welcome to the Prison Talk Online Community! Take a Minute and Sign Up Today!






Go Back   Prison Talk > BREAK TIME > Continuing and Adult Education
Register Entertainment FAQ Calendar Mark Forums Read

Notices

Continuing and Adult Education Discuss college and continuing education.

Reply
 
Thread Tools Display Modes
  #1  
Old 05-07-2012, 08:34 PM
Princess1029's Avatar
Princess1029 Princess1029 is offline
Registered User
 

Join Date: Aug 2011
Location: N/A
Posts: 4,278
Thanks: 956
Thanked 758 Times in 632 Posts
Default Couple Chemistry questions

I am needing some help on these chemistry questions I cannot figure it out..

First one is..

Use diagrams to summeriza and explain the sequence of events in the three stages of protein synthesis (initiation, elongation, and termination)

The other is...

Given the following sequence of double stranded nucleotides, replicate the DNA.
Next transcribe the strand which begins with the nucleotides sequence TAC.
Finally translate the mRNA you produced from the transcription above.

TACCGCGGGTATCCCAAATTTCGCATT
ATGGCGCCCATAGGGTTTAAAGCGTAA


Anyone that can help that would be AMAZINGGGG

Thank you
__________________
*Always have faith*
* Love him ALWAYS & FOREVER*








Reply With Quote
Sponsored Links
Reply

Bookmarks

Thread Tools
Display Modes

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off
Forum Jump


All times are GMT -6. The time now is 03:26 AM.
Copyright © 2001- 2013 Prison Talk Online
Powered by vBulletin® Version 3.7.4
Copyright ©2000 - 2013, Jelsoft Enterprises Ltd.
Website Design & Custom vBulletin Skins by: Relivo Media
Message Board Statistics