Couple Chemistry questions

Welcome to the Prison Talk Online Community! Take a Minute and Sign Up Today!

		Prison Talk > BREAK TIME > Continuing and Adult Education
Couple Chemistry questions

Entertainment

FAQ

Calendar

Mark Forums Read

Notices

Notice to new members intending to register - from January 9th 2012

Please be aware that, due to difficulties arising from issues with Yahoo and AOL, we have changed our registration requirements.

Users with email addresses from yahoo.com, yahoo.co.uk and aol.com will no longer be able to use them to create a new account.
We have had a long-standing problems with these mail services and have found that it is almost impossible to send out account activations to new users who have Yahoo or AOL providers.

Please use an alternative email address; hotmail, gmail etc.

Thanks for your attention.
Rachel
Administrator

Introducing PTO Quarterly - Spring 2013 Issue

PTO is proud to present the first issue of PTO Quarterly. This new venture is a newsletter in an online format. It has been produced in both Word and PDF formats that you can read while online, download to your computer, and even print to send a copy to your loved one.

Please click on the link to view the very first issue : PTO Quarterly

Continuing and Adult Education Discuss college and continuing education.

Thread Tools

Display Modes

05-07-2012, 08:34 PM

Princess1029 Princess1029 is offline

Registered User

Join Date: Aug 2011

Location: N/A

Posts: 4,278

Thanks: 956

Thanked 758 Times in 632 Posts

Couple Chemistry questions

I am needing some help on these chemistry questions I cannot figure it out..

First one is..

Use diagrams to summeriza and explain the sequence of events in the three stages of protein synthesis (initiation, elongation, and termination)

The other is...

Given the following sequence of double stranded nucleotides, replicate the DNA.
Next transcribe the strand which begins with the nucleotides sequence TAC.
Finally translate the mRNA you produced from the transcription above.

TACCGCGGGTATCCCAAATTTCGCATT
ATGGCGCCCATAGGGTTTAAAGCGTAA

Anyone that can help that would be AMAZINGGGG

Thank you

__________________
*Always have faith*
* Love him ALWAYS & FOREVER*